In my experience there are three types of people who reject evolution: People who don't understand it, People who are willfully ignorant of the subject, and con-artists lying about it to exploit the before mentioned.
Why do people reject evolution?
- Thread starter disgruntledgamer
- Start date
Recommended Videos
I was oversimplifying that the nature of science and facts fit into the white labcoat that current theory gives to them.TheKasp said:For statement in the picture to get the status of a theory you would neet to have a lot of evidence to support the hypothesis.StrangerQ said:Because in the end it is just a THEORY and how to dictionary states it.
(sciences) A coherent statement or set of ideas that explains observed facts or phenomena, or which sets out the laws and principles of something known or observed; a hypothesis confirmed by observation, experiment etc. [from 17th c.]
Since it is a theory one can quite easily make a other theory that:
However Evolution happens to be quite well explained and etc. which leans me to trust this concept of sharing dna and
common ancestor with apes.
Also, you seem to not understand what a scientific theory is.
A scientific theory is an explanation of aspects of the natural world (as in evolution) based on a body of facts (!) that can be (and were) reproduced in experiments and obeservations.
To quote wiki:
"Scientific theories are the most reliable, rigorous, and comprehensive form of scientific knowledge."
go one thousand years back and do tell the people about scientific facts which suprise suprise do not fit their "accepted" bishop robed facts.
To understand knowledge, truth, facts and everything is to keep mind open and accept that people have right to think that they are right. To go and yell that they are wrong just imprisons you to certain aspect of rainbow instead allowing one to see all the colors and the other rainbows.
CAPTCHA
meat and drink - is what im having right now
I am, but for reasons other than what you are trying to falsely assert. Now, watch me address a question instead of dodging it, and marvel at the ease with which it's done.wulf3n said:
Natural selection IS evidence of evolution. Natural selection is a crucial part of evolution. It's the process by which evolution occurs. trying to separate the two is dishonest.
The point being that you do not speak for others, merely yourself. Nice dodge by claiming I'm not "countering" a point, though.
Of course, it wasn't random. You are going after people for arguments not presented.
If you plug your ears and scream "lalalalala I'm not listening," perhaps. Do you want an real conversation, or no?
Who is really arguing otherwise?
Glib, which is one thing Einstein was known for.
Again, strawman. Please don't misrepresent me. I would ask you to limit your criticism to things I've actually said and done.
But I'll play along. What questions doesn't evolution answer? What evidence do I specifically need to provide? Perhaps I can actually help you here by providing something you seem to be missing heavily.
Actually, I don't. It seems you are doing just what you claim I am doing; assuming that I am some sort of polar radical simply because I take you to task.
Question: have I ever once called you a creationist? I think the most I said was I could convince you of evolution no more than I could explain how magnets work to ICP. That doesn't mention creationism, it merely addresses your current arguments about so-called flaws in the system that I am evidently supposed to rebut even though you have not mentioned them.
Again, you impose artificial distinctions.
Heredity is an important part of evolution.
Because of the difference between 'theory' and 'scientific theory'. People hear the 'theory' of evolution and think it's just a guess, like saying "I have a theory on who ate the last biscuit", not something that has mounds of evidence to support it.
It also doesn't help that the term 'law' is used also. Since a law always applies, evolution can never be a law as it's just too random, there's no straight-forward X+Y=Z that will tell you how things will look (well there might but you'll need deep-thought to solve it)
Really science classes should teach the scientific method first, before anything else. Teach kids that a theory is not just something someone thought up for a laugh and they might stop believing all the creationist bullshit, and we're the last generation that has to put up with this mind-numbingly retarded argument.
It also doesn't help that the term 'law' is used also. Since a law always applies, evolution can never be a law as it's just too random, there's no straight-forward X+Y=Z that will tell you how things will look (well there might but you'll need deep-thought to solve it)
Really science classes should teach the scientific method first, before anything else. Teach kids that a theory is not just something someone thought up for a laugh and they might stop believing all the creationist bullshit, and we're the last generation that has to put up with this mind-numbingly retarded argument.
Because people become so ridiculously dependent on their beliefs (mind you, this goes for EVERYONE, not just religious people) that even the most logical arguments against their beliefs will be ignored, twisted, misunderstood, etc.
It just so happens that most (if not all) religious beliefs are so utterly illogical and primitive that it causes their followers to reject anything that may go against them, apparently even reality.
It just so happens that most (if not all) religious beliefs are so utterly illogical and primitive that it causes their followers to reject anything that may go against them, apparently even reality.
I'd just like to correct you here, firstly about the speed of light, which can be measured accurately using a device called an interferometer. Secondly, the speed of light is actually defined to be 299792458m/s exactly, which means the actual problem is to measure the length of a metre.maddawg IAJI said:
Thirdly, evolution can and has been observed, both in nature and in laboratory conditions. Whether it be the observation of speciation in Galapagos finches (http://www.pnas.org/content/early/2009/11/12/0911761106.full.pdf+html), or the observation of emergence of new traits in bacterial populations, such as the ability to digest nylon or citrate (http://web.mst.edu/~microbio/BIO221_2010/Flavobacterium.html and http://www.pnas.org/content/105/23/7899.full.pdf+html).
This was a miscommunication of terms. As it turns out I have a broader definition of the word "Evolution" than most.Zachary Amaranth said:
I didn't know you countered a point, because I had no idea what you were saying, and I was talking in general. While everyone may not fall into that category, the majority in my observations have.
I was pointing out that everyone [by which I mean evolutionists] started jumping down my throat because I asked for evidence. It wasn't so much directed at you as opposition to your arguments, but as a general question.
I'm getting kind of tired of this topic.
That's pretty much what I've been arguing for, in the last 5 pages.
Doesn't make it any less valid.
I apologise, that wasn't directed just at you, and was more of a reactionary statement.
How non-beneficial (but not detrimental) mutations propagate through a species?
Again, not really you, you, just in general and a reactionary statement.
Doug said:
Only a few? We can handle that!
To the science mobile!
captcha: Yes, ma'am
Damn straight!
That ones easy and it can happen in different ways, one way is through simply piggybacking along with beneficial mutations, a silent but non harmful gen can easily spread through an entire population if set organism has other gens that give it a significant edge. Another method is through sexual selection, if say blue eyes or pointy ears became a very sought after trait for males seeking females the blue eyed pointy eared women are going to have more children.wulf3n said:
Genetic drift is the name given to this phenomenon, it has an entire field of study and a name for the effect. This isnt an unknown at all. Gene linkage also accounts for it. Sometimes a mutation will cause a desirable change AND a neutral change with it. Most mutations are neutral btw, they change a part of the DNA that doesnt code for anything or change it in a way that doesnt change a protein structure (because there are multiple codes for the same protien in DNA)wulf3n said:
Lets say a species gains two desirable traits over the course of a 3 million years (silly but its an example):
The mutation is random so the first mutation causes this: ATCGTCGATCATCGGGCTAATCGGCTAC
The bold represents the part that codes for the protein that causes the good change. A LOT of DNA is total junk, so over time random bits of junk will build up. However when someone gets a beneficial mutation the junk THEY have will become the populations junk because THEIR genetics are now being selected for, junk and all. So lets look at mutation 2.
ATCGGGCATCCCAT
The bold is important. This is selected for so now most offspring will have all this "junk" with their regular genes.
ATCGGGCATCCCATATCGTCGATCATCGGGCTAATCGGCTAC Is now ALL the junk we have together in our population, and its likely most people will have it or something like it because each time a mutation occurred the one who was selected for also had all this junk.
Also random chance. Just by chance it can totally happen, especially if the random junk is dominant and will overwrite the random junk from your partner when the zygote forms. Heres a gif of how it happens! The selection is random because we assume that ALL mutations during this time a neutral, no real selection is occuring. Since SO MUCH JUNK is passed on all the time the chances of some becoming more common and some becoming less common is pretty likely.
This is genetic drift. You can do this at home. Take a coin and flip it 10 times, then write down the results, number them from 1 to 10. You now need a random number generator from 1 to 10. When it generates a number take that number result from your original sample and pass it on until you have 10 more results. Then do it again. Keep going. Chances are one result will start being dominant over another result.
I have never actually met anyone that rejects evolution theory, but I guess it's possible that there are people out there who do. I don't really care though: it's not like it will have a serious impact on your life, you can do whatever you want as long as you don't harm anyone else.
It simply doesn't hold up to critical scrutiny. It's a fairy tale dressed up in pseudo-scientific jargon and pounded into young minds in the government schools.
People religiously defend it not because it's correct, but because they WANT to believe it over other explanations of existence, for various reasons.
It is estimated that a species cannot propagate itself with less that 5,000 members of that species in existence. Imagine if one of those 5,000 members was born with the mutation of a weird bump on his head. What would happen -- all of the females of his species would find him incredibly attractive and jump his bones and over a thousand generations later, the weird bump has become a horn that aids in survival? Or, if the weird creature was even allowed to mate at all, wouldn't the bump simply be absorbed into the gene pool and disappear? Now imagine that the weird-bump-creature is not just one of 5,000, but one out of several million. Even less likely now, isn't it? And I could go on about this all day, pointing out things, such as the reality that mutation is almost always a BAD thing for survival.
No, when you really stop to think about things objectively and critically, the millions and millions of layers of improbability surrounding evolutionary theory quickly turn into impossibility.
People religiously defend it not because it's correct, but because they WANT to believe it over other explanations of existence, for various reasons.
It is estimated that a species cannot propagate itself with less that 5,000 members of that species in existence. Imagine if one of those 5,000 members was born with the mutation of a weird bump on his head. What would happen -- all of the females of his species would find him incredibly attractive and jump his bones and over a thousand generations later, the weird bump has become a horn that aids in survival? Or, if the weird creature was even allowed to mate at all, wouldn't the bump simply be absorbed into the gene pool and disappear? Now imagine that the weird-bump-creature is not just one of 5,000, but one out of several million. Even less likely now, isn't it? And I could go on about this all day, pointing out things, such as the reality that mutation is almost always a BAD thing for survival.
No, when you really stop to think about things objectively and critically, the millions and millions of layers of improbability surrounding evolutionary theory quickly turn into impossibility.
Who estimated... you cant just pull out facts like that.Falcon Stormvoice said:
Mutations dont cause things like that all at once. They change the structure of a single protien.
No one thinks this is true. This also isnt how evolution works at all. Whole features dont evolve all at once with a useless build up to something useful. Smaller iterations become more complex, and every stage is useful in some shape or form.
Yep mutations are rare. Evolution happens over a LONG time and ONLY beneficial mutations are selected for. Not random things like useless bumps. Your example isnt something anyone who trusted evolution would ever say would happen. Its bizarre quite frankly.
Planets almost always have no life on them. Roll the dice enough times and youre gonna get a positive result no matter how unlikely. A million years and several million samples is a lot of dice roles. I encourage you to go on. Every single hole your picking is just a misconception about evolution that you have. Seriously read about it. Youre not representing it how it actually is at all.
Everything you have said tells me you dont even understand what youre thinking about. You arnt thinking about evolution but instead some bizare strawman of it with many flaws.
The only thing i agree on is its not being taught correctly. Drilling it in is worthless. The hoard of evidence and logic behind it need to be addressed too. This paragraph was like you didnt even know how natural selection was related to evolution... and thats not good. Teaching of evolution needs to be more rational and evidence based. It might be too late for you but we can properly teach it to others covering these silly misconceptions that everyone seems to have. No one to this date i have spoken to has understood it properly and rejected it. This is telling me something is wrong with the education system covering this topic.
Either you're a troll and you're having a lot of fun here or you're an actual believer in the bile you're spouting and obviously suffer from some sort of nuerological condition that causes you to surrender your critical faculties. That being said, can you really blame people for assuming that you're a troll when the alternative is that you really are THAT stupid?Aglynugga said:
You shouldn't put faith in the Bible's relevance with regards to MODERN SCIENCE when it claims that the Earth is flat and six thousand years old, Heaven is above the sky and Hell below the ground and that the Sun goes around the Earth.
Asita said:
Now i shall try to explain what i meant.TheKasp said:
A.I agree throwing hands up in the air and calling hard things supernatural and shit is being close minded.
B.I agree that silly supernatural things should be critically judged and considered or you are throwing your hands in the air and not proving shit,
C.I am just saying that too many people yell science now instead of supernatural.
D.I am trying to say that all possibilities should allways be considered including science and green underwear stealing goblins
That's the problem.TehCookie said:
Evolution theory is a SCIENCE. It should not be relegated to 'Religion and Politics' because it is neither religious, nor political.
The ONLY reason it would go there is because Anti-Evolution proponents do so for religious reasons and use politics as their vehicle to do so.
All things, in science, should be considered according to scientific merit. Hypotheses where scientific work is not or CANNOT be done are not to be considered of equal merit to theories which HAVE.StrangerQ said:
Evolution is the best explanation science has to offer--it's the only one that explains the evidence, that produces reliable predictions, and can bring forth technologies that improve our lives for the future. It is tested, demonstrated, and retested.
Complaining that people are just saying 'It's science' as if that were enough to end the discussion is discrediting what science IS. It's a very rigorous process of testing and throwing the results to the wolves to tear apart. Only good ideas will survive scientific rigor, and only BETTER ideas can surpass them.
It's the process itself which guarantees that. Nothing is taken on faith. Scientists don't simply accept an experiment, they redo the experiment to see if the work was done right. Disproving a commonly accepted theory is the best way to scientific fame--Einstein is known for relativity because it replaced newton's gravity. No one remembers what he got his nobel prize for.
Can I have your Source please. I have a feeling either it's propaganda, misread or doesn't exist.Falcon Stormvoice said:
This is the single best explanation of evolutionary misconceptions i have seen. Now "Complicated psueudo science words" or anything. Basic and clear explanation.
Falcon Stormvoice said:
I don't understand your rebuttal.
It shows a fundamental lack of understanding of how GENETICS work, never mind evolution.
In fact, how can you accept genetics and NOT accept evolution? Gene theory includes evolution theory as a part of it--as gene theory is the explanation for how heredity happens.
Let's take a different tack with this.
1) Do you agree or disagree that life reproduces itself?
1a) Assuming you agree, do you agree or disagree that there is a mechanism by which life can transfer some of its attributes to its offspring?
2) Do you agree or disagree that the process is imperfect, and that even something as simple as 'mommy has different hair than daddy' means that a child can end up with traits that neither parent have?
3a) Do you agree or disagree that sometimes living organisms possess traits that make them less likely to survive?
3b) Do you agree or disagree that sometimes living organisms possess traits that make mating more or less difficult, either through physical frailty, or through being less attractive to potential mates?
Mathematical analysis has proven that if 1a is true, 2 is true, and EITHER 3a OR 3b are true, evolution is not only possible, but a guaranteed inevitability. In order to disprove evolution as a process, you MUST disagree with 1a, 2, or 3a AND 3b.
Now, seeing as it's common knowledge that
a) animals can fuck,
b) animals that fuck have kids,
c) animals that fuck and have kids tend to have kids that are not like either parent but a mix
d) animals that fuck tend to want to fuck more fuckable animals
e) animals that fuck need to live long enough to fuck because dead things can't fuck
And that all of those are true for humans, where is your evidence or argument that evolution is false?
In other words, can you disprove that animals fuck?