Why do people reject evolution?

Recommended Videos

kickyourass

New member
Apr 17, 2010
1,427
0
0
In my experience there are three types of people who reject evolution: People who don't understand it, People who are willfully ignorant of the subject, and con-artists lying about it to exploit the before mentioned.
 

StrangerQ

New member
Oct 14, 2009
327
0
0
TheKasp said:
StrangerQ said:
Because in the end it is just a THEORY and how to dictionary states it.

(sciences) A coherent statement or set of ideas that explains observed facts or phenomena, or which sets out the laws and principles of something known or observed; a hypothesis confirmed by observation, experiment etc. [from 17th c.]

Since it is a theory one can quite easily make a other theory that:



However Evolution happens to be quite well explained and etc. which leans me to trust this concept of sharing dna and
common ancestor with apes.
For statement in the picture to get the status of a theory you would neet to have a lot of evidence to support the hypothesis.
Also, you seem to not understand what a scientific theory is.

A scientific theory is an explanation of aspects of the natural world (as in evolution) based on a body of facts (!) that can be (and were) reproduced in experiments and obeservations.

To quote wiki:

"Scientific theories are the most reliable, rigorous, and comprehensive form of scientific knowledge."
I was oversimplifying that the nature of science and facts fit into the white labcoat that current theory gives to them.
go one thousand years back and do tell the people about scientific facts which suprise suprise do not fit their "accepted" bishop robed facts.

To understand knowledge, truth, facts and everything is to keep mind open and accept that people have right to think that they are right. To go and yell that they are wrong just imprisons you to certain aspect of rainbow instead allowing one to see all the colors and the other rainbows.

CAPTCHA
meat and drink - is what im having right now
 

Asita

Answer Hazy, Ask Again Later
Legacy
Jun 15, 2011
3,330
1,227
118
Country
USA
Gender
Male
StrangerQ said:
To understand knowledge, truth, facts and everything is to keep mind open and accept that people have right to think that they are right. To go and yell that they are wrong just imprisons you to certain aspect of rainbow instead allowing one to see all the colors and the other rainbows.
You seem to misunderstand what the phrase "Open Minded" means. It's been linked in this thread before, but you might want to give this video a look.

 

Something Amyss

Aswyng and Amyss
Dec 3, 2008
24,756
0
0
wulf3n said:
Dodging the question by claiming I'm dodging the question... clever girl.
I am, but for reasons other than what you are trying to falsely assert. Now, watch me address a question instead of dodging it, and marvel at the ease with which it's done.

Ok I'll play, what evidence have I dodged?
Natural selection IS evidence of evolution. Natural selection is a crucial part of evolution. It's the process by which evolution occurs. trying to separate the two is dishonest.

who's john? and again you've yet to counter a point.
The point being that you do not speak for others, merely yourself. Nice dodge by claiming I'm not "countering" a point, though.

You know typing random buzz words isn't as effective as you may think it is.
Of course, it wasn't random. You are going after people for arguments not presented.

So there we have it, yet again you've provided evidenced that you're no better than those arguing creationism.
If you plug your ears and scream "lalalalala I'm not listening," perhaps. Do you want an real conversation, or no?

Do you know the one of the fundamental tenets of science is that nothing can ever truly be proven, and to believe a theory as fact is foolish.
Who is really arguing otherwise?

Albert Einstein - "No amount of experimentation can ever prove me right; a single experiment can prove me wrong."
Glib, which is one thing Einstein was known for.

And yet, as soon as someone questions said theory or asks for evidence, you just say they're wrong and must believe in creationism rather than you know provide evidence or admit that the theory of evolution doesn't answer 100% of it's questions.
Again, strawman. Please don't misrepresent me. I would ask you to limit your criticism to things I've actually said and done.

But I'll play along. What questions doesn't evolution answer? What evidence do I specifically need to provide? Perhaps I can actually help you here by providing something you seem to be missing heavily.

It's that you spout it like it is doctrine from a higher power that's the problem.
Actually, I don't. It seems you are doing just what you claim I am doing; assuming that I am some sort of polar radical simply because I take you to task.

Question: have I ever once called you a creationist? I think the most I said was I could convince you of evolution no more than I could explain how magnets work to ICP. That doesn't mention creationism, it merely addresses your current arguments about so-called flaws in the system that I am evidently supposed to rebut even though you have not mentioned them.

Natural Selection is existing genetic traits becoming more desirable due to environmental factors, causing a change in a species. But the changes already existed in the genetic code.

Evolution is changes to a species that don't exist in genetic code.
Again, you impose artificial distinctions.

Heredity is an important part of evolution.
 

Karma168

New member
Nov 7, 2010
541
0
0
Because of the difference between 'theory' and 'scientific theory'. People hear the 'theory' of evolution and think it's just a guess, like saying "I have a theory on who ate the last biscuit", not something that has mounds of evidence to support it.

It also doesn't help that the term 'law' is used also. Since a law always applies, evolution can never be a law as it's just too random, there's no straight-forward X+Y=Z that will tell you how things will look (well there might but you'll need deep-thought to solve it)


Really science classes should teach the scientific method first, before anything else. Teach kids that a theory is not just something someone thought up for a laugh and they might stop believing all the creationist bullshit, and we're the last generation that has to put up with this mind-numbingly retarded argument.
 

Eggsnham

New member
Apr 29, 2009
4,052
0
0
Because people become so ridiculously dependent on their beliefs (mind you, this goes for EVERYONE, not just religious people) that even the most logical arguments against their beliefs will be ignored, twisted, misunderstood, etc.

It just so happens that most (if not all) religious beliefs are so utterly illogical and primitive that it causes their followers to reject anything that may go against them, apparently even reality.
 

Redingold

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Mar 28, 2009
1,633
0
0
maddawg IAJI said:
3) You can test the theory of evolution in the same manner you prove the speed of light or the theory of Pangea. You can't,(Actually, I'm probably wrong about Pangea. I'm pretty sure that's been proven.) and no single human being is ever going to be able to. Evolution is the gradual change over time through mutation in response to stimuli in the environmental. The change is gradual. We're not going to experience it within our lifetime and we can't force it with the technology we currently have (Not to mention the ethical problems that come with it.)
I'd just like to correct you here, firstly about the speed of light, which can be measured accurately using a device called an interferometer. Secondly, the speed of light is actually defined to be 299792458m/s exactly, which means the actual problem is to measure the length of a metre.

Thirdly, evolution can and has been observed, both in nature and in laboratory conditions. Whether it be the observation of speciation in Galapagos finches (http://www.pnas.org/content/early/2009/11/12/0911761106.full.pdf+html), or the observation of emergence of new traits in bacterial populations, such as the ability to digest nylon or citrate (http://web.mst.edu/~microbio/BIO221_2010/Flavobacterium.html and http://www.pnas.org/content/105/23/7899.full.pdf+html).
 

wulf3n

New member
Mar 12, 2012
1,394
0
0
Zachary Amaranth said:
Natural selection IS evidence of evolution. Natural selection is a crucial part of evolution. It's the process by which evolution occurs. trying to separate the two is dishonest.
This was a miscommunication of terms. As it turns out I have a broader definition of the word "Evolution" than most.

who's john? and again you've yet to counter a point.
The point being that you do not speak for others, merely yourself. Nice dodge by claiming I'm not "countering" a point, though.
I didn't know you countered a point, because I had no idea what you were saying, and I was talking in general. While everyone may not fall into that category, the majority in my observations have.

You know typing random buzz words isn't as effective as you may think it is.
Of course, it wasn't random. You are going after people for arguments not presented.
I was pointing out that everyone [by which I mean evolutionists] started jumping down my throat because I asked for evidence. It wasn't so much directed at you as opposition to your arguments, but as a general question.

So there we have it, yet again you've provided evidenced that you're no better than those arguing creationism.
If you plug your ears and scream "lalalalala I'm not listening," perhaps. Do you want an real conversation, or no?
I'm getting kind of tired of this topic.

Do you know the one of the fundamental tenets of science is that nothing can ever truly be proven, and to believe a theory as fact is foolish.
Who is really arguing otherwise?
That's pretty much what I've been arguing for, in the last 5 pages.

Albert Einstein - "No amount of experimentation can ever prove me right; a single experiment can prove me wrong."
Glib, which is one thing Einstein was known for.
Doesn't make it any less valid.

And yet, as soon as someone questions said theory or asks for evidence, you just say they're wrong and must believe in creationism rather than you know provide evidence or admit that the theory of evolution doesn't answer 100% of it's questions.
Again, strawman. Please don't misrepresent me. I would ask you to limit your criticism to things I've actually said and done.
I apologise, that wasn't directed just at you, and was more of a reactionary statement.

But I'll play along. What questions doesn't evolution answer? What evidence do I specifically need to provide? Perhaps I can actually help you here by providing something you seem to be missing heavily.
How non-beneficial (but not detrimental) mutations propagate through a species?

It's that you spout it like it is doctrine from a higher power that's the problem.
Actually, I don't. It seems you are doing just what you claim I am doing; assuming that I am some sort of polar radical simply because I take you to task.

Question: have I ever once called you a creationist? I think the most I said was I could convince you of evolution no more than I could explain how magnets work to ICP. That doesn't mention creationism, it merely addresses your current arguments about so-called flaws in the system that I am evidently supposed to rebut even though you have not mentioned them.
Again, not really you, you, just in general and a reactionary statement.
 

AwesomeWunderbar

New member
Jul 31, 2012
41
0
0
Doug said:
AwesomeWunderbar said:
Doug said:
AwesomeWunderbar said:
disgruntledgamer said:
One of the strongest scientific theories to date, even stronger than the theory of Gravity
Gravity isn't a theory, it's a law.
If you volatile it, the reality police drag you off to...somewhere. We think its hiding behind the Higgs-Boson. Hence, the search for it. If we destroy the prison, gravity need no longer bind us!
But that wouldn't be good! Cause then we'd float out into space and our heads would explode!
You can't make an anti-gravity device without causing a few apocalypses.

Only a few? We can handle that!

To the science mobile!

captcha: Yes, ma'am

Damn straight!
 

disgruntledgamer

New member
Mar 6, 2012
903
0
0
wulf3n said:
How non-beneficial (but not detrimental) mutations propagate through a species?
That ones easy and it can happen in different ways, one way is through simply piggybacking along with beneficial mutations, a silent but non harmful gen can easily spread through an entire population if set organism has other gens that give it a significant edge. Another method is through sexual selection, if say blue eyes or pointy ears became a very sought after trait for males seeking females the blue eyed pointy eared women are going to have more children.
 

BiscuitTrouser

Elite Member
May 19, 2008
2,859
0
41
wulf3n said:
How non-beneficial (but not detrimental) mutations propagate through a species?
Genetic drift is the name given to this phenomenon, it has an entire field of study and a name for the effect. This isnt an unknown at all. Gene linkage also accounts for it. Sometimes a mutation will cause a desirable change AND a neutral change with it. Most mutations are neutral btw, they change a part of the DNA that doesnt code for anything or change it in a way that doesnt change a protein structure (because there are multiple codes for the same protien in DNA)

Lets say a species gains two desirable traits over the course of a 3 million years (silly but its an example):

The mutation is random so the first mutation causes this: ATCGTCGATCATCGGGCTAATCGGCTAC

The bold represents the part that codes for the protein that causes the good change. A LOT of DNA is total junk, so over time random bits of junk will build up. However when someone gets a beneficial mutation the junk THEY have will become the populations junk because THEIR genetics are now being selected for, junk and all. So lets look at mutation 2.

ATCGGGCATCCCAT

The bold is important. This is selected for so now most offspring will have all this "junk" with their regular genes.

ATCGGGCATCCCATATCGTCGATCATCGGGCTAATCGGCTAC Is now ALL the junk we have together in our population, and its likely most people will have it or something like it because each time a mutation occurred the one who was selected for also had all this junk.

Also random chance. Just by chance it can totally happen, especially if the random junk is dominant and will overwrite the random junk from your partner when the zygote forms. Heres a gif of how it happens! The selection is random because we assume that ALL mutations during this time a neutral, no real selection is occuring. Since SO MUCH JUNK is passed on all the time the chances of some becoming more common and some becoming less common is pretty likely.



This is genetic drift. You can do this at home. Take a coin and flip it 10 times, then write down the results, number them from 1 to 10. You now need a random number generator from 1 to 10. When it generates a number take that number result from your original sample and pass it on until you have 10 more results. Then do it again. Keep going. Chances are one result will start being dominant over another result.
 

Mau95

Senior Member
Nov 11, 2011
347
0
21
I have never actually met anyone that rejects evolution theory, but I guess it's possible that there are people out there who do. I don't really care though: it's not like it will have a serious impact on your life, you can do whatever you want as long as you don't harm anyone else.
 

Falcon Stormvoice

New member
Apr 18, 2012
7
0
0
It simply doesn't hold up to critical scrutiny. It's a fairy tale dressed up in pseudo-scientific jargon and pounded into young minds in the government schools.

People religiously defend it not because it's correct, but because they WANT to believe it over other explanations of existence, for various reasons.

It is estimated that a species cannot propagate itself with less that 5,000 members of that species in existence. Imagine if one of those 5,000 members was born with the mutation of a weird bump on his head. What would happen -- all of the females of his species would find him incredibly attractive and jump his bones and over a thousand generations later, the weird bump has become a horn that aids in survival? Or, if the weird creature was even allowed to mate at all, wouldn't the bump simply be absorbed into the gene pool and disappear? Now imagine that the weird-bump-creature is not just one of 5,000, but one out of several million. Even less likely now, isn't it? And I could go on about this all day, pointing out things, such as the reality that mutation is almost always a BAD thing for survival.

No, when you really stop to think about things objectively and critically, the millions and millions of layers of improbability surrounding evolutionary theory quickly turn into impossibility.
 

BiscuitTrouser

Elite Member
May 19, 2008
2,859
0
41
Falcon Stormvoice said:
It is estimated that a species cannot propagate itself with less that 5,000 members of that species in existence.
Who estimated... you cant just pull out facts like that.

Imagine if one of those 5,000 members was born with the mutation of a weird bump on his head.
Mutations dont cause things like that all at once. They change the structure of a single protien.

What would happen -- all of the females of his species would find him incredibly attractive and jump his bones and over a thousand generations later, the weird bump has become a horn that aids in survival?
No one thinks this is true. This also isnt how evolution works at all. Whole features dont evolve all at once with a useless build up to something useful. Smaller iterations become more complex, and every stage is useful in some shape or form.

Or, if the weird creature was even allowed to mate at all, wouldn't the bump simply be absorbed into the gene pool and disappear? Now imagine that the weird-bump-creature is not just one of 5,000, but one out of several million.
Yep mutations are rare. Evolution happens over a LONG time and ONLY beneficial mutations are selected for. Not random things like useless bumps. Your example isnt something anyone who trusted evolution would ever say would happen. Its bizarre quite frankly.


Even less likely now, isn't it? And I could go on about this all day, pointing out things, such as the reality that mutation is almost always a BAD thing for survival.
Planets almost always have no life on them. Roll the dice enough times and youre gonna get a positive result no matter how unlikely. A million years and several million samples is a lot of dice roles. I encourage you to go on. Every single hole your picking is just a misconception about evolution that you have. Seriously read about it. Youre not representing it how it actually is at all.

No, when you really stop to think about things objectively and critically, the millions and millions of layers of improbability surrounding evolutionary theory quickly turn into impossibility.
Everything you have said tells me you dont even understand what youre thinking about. You arnt thinking about evolution but instead some bizare strawman of it with many flaws.

The only thing i agree on is its not being taught correctly. Drilling it in is worthless. The hoard of evidence and logic behind it need to be addressed too. This paragraph was like you didnt even know how natural selection was related to evolution... and thats not good. Teaching of evolution needs to be more rational and evidence based. It might be too late for you but we can properly teach it to others covering these silly misconceptions that everyone seems to have. No one to this date i have spoken to has understood it properly and rejected it. This is telling me something is wrong with the education system covering this topic.
 

irishmanwithagun

New member
Mar 6, 2012
50
0
0
Aglynugga said:
Quaxar said:
JoJo said:
Aglynugga said:
My ancestors weren't monkeys ok, is that what you want to teach your kids? Bring your child to the zoo and bring them to the chimps and points to them then say' Look its your gradparents wave hello and give them a kiss."? No! That is not right we come from the bible like God says Adam and Eve not Davey and Steve and there was a snake.
So I say to you look in your heart and see that God made you and he made you very special and you are not made from monkeys.
You are a brave man my friend.
He's not brave but simply a troll, you can look at his posting record for that. Also, damn you other biology students for replying before I had a chance to type out my text. I'm having a big exam coming up with that being one of the major parts.

Let me at least say that what religion someone has doesn't necessarily matter. I personally don't really care if you're Christian, Buddhist, Atheist or part of that Shiva cult from Indiana Jones if you're willing to listen to explanations instead of dismissing it all because an old book or a mystic stone stolen from an Indian village tells you so. If the pope can agree with science then there is every possibility of accepting it yourself.
And please never listen to anything said by anyone who calls himself a "creation scientist". If you have ever seen a single Kent Hovind video and actually knew the topic he rambled about you'd understand why. For example he has his own little "theory of evolution(s)" where he also likes to throw in things like "stellar evolution"the formation of stars and planets, "chemical evolution"meaning, the evolution of hydrogen into higher elements or "cosmic evolution"apparently the evolution of time & space.
I could go further and talk a lot about this idiocracy but I think and hope we can all agree on this.

No man you listen to this because it is in the bible. You can't say oh no this man is religious I will call him a troll and then he will not be listened to so people will not hear about god. But if i am a troll i am a troll for God because I will not let you try to make people think that they are monkeys or came from the sea like mermaids. You don't understand because you are probably an atheist and never read the bible anyways you proabaly read the koran like some terrorists do. But you know what even though you are against god and would let people worship satan and things I know you have to love and tolerate me because your satan pony makes you.
People U need to love God and let him into your heart. He is your maker not crazy monkeys or satan.
Either you're a troll and you're having a lot of fun here or you're an actual believer in the bile you're spouting and obviously suffer from some sort of nuerological condition that causes you to surrender your critical faculties. That being said, can you really blame people for assuming that you're a troll when the alternative is that you really are THAT stupid?
You shouldn't put faith in the Bible's relevance with regards to MODERN SCIENCE when it claims that the Earth is flat and six thousand years old, Heaven is above the sky and Hell below the ground and that the Sun goes around the Earth.
 

StrangerQ

New member
Oct 14, 2009
327
0
0
Asita said:
StrangerQ said:
To understand knowledge, truth, facts and everything is to keep mind open and accept that people have right to think that they are right. To go and yell that they are wrong just imprisons you to certain aspect of rainbow instead allowing one to see all the colors and the other rainbows.
You seem to misunderstand what the phrase "Open Minded" means. It's been linked in this thread before, but you might want to give this video a look.

TheKasp said:
StrangerQ said:
To understand knowledge, truth, facts and everything is to keep mind open and accept that people have right to think that they are right. To go and yell that they are wrong just imprisons you to certain aspect of rainbow instead allowing one to see all the colors and the other rainbows.

CAPTCHA
meat and drink - is what im having right now
But in the case of anything involving supernatural explanations it results in people closing their mind because they throw their arms up and yell "God did it so we can't understand it!". To have an open mind does not mean to accept every bullshit someone claims - especially when their 'theory' has no recreationable observations or any kind of evidence to build upon.

Well yes, people have a right to think they are right. As well as I have a right to tell them that they are factually wrong.
Now i shall try to explain what i meant.

A.I agree throwing hands up in the air and calling hard things supernatural and shit is being close minded.
B.I agree that silly supernatural things should be critically judged and considered or you are throwing your hands in the air and not proving shit,
C.I am just saying that too many people yell science now instead of supernatural.
D.I am trying to say that all possibilities should allways be considered including science and green underwear stealing goblins
 

DracoSuave

New member
Jan 26, 2009
1,685
0
0
TehCookie said:
I think this belongs in Religion and Politics
That's the problem.

Evolution theory is a SCIENCE. It should not be relegated to 'Religion and Politics' because it is neither religious, nor political.

The ONLY reason it would go there is because Anti-Evolution proponents do so for religious reasons and use politics as their vehicle to do so.

StrangerQ said:
D.I am trying to say that all possibilities should allways be considered including science and green underwear stealing goblins
All things, in science, should be considered according to scientific merit. Hypotheses where scientific work is not or CANNOT be done are not to be considered of equal merit to theories which HAVE.

Evolution is the best explanation science has to offer--it's the only one that explains the evidence, that produces reliable predictions, and can bring forth technologies that improve our lives for the future. It is tested, demonstrated, and retested.

Complaining that people are just saying 'It's science' as if that were enough to end the discussion is discrediting what science IS. It's a very rigorous process of testing and throwing the results to the wolves to tear apart. Only good ideas will survive scientific rigor, and only BETTER ideas can surpass them.

It's the process itself which guarantees that. Nothing is taken on faith. Scientists don't simply accept an experiment, they redo the experiment to see if the work was done right. Disproving a commonly accepted theory is the best way to scientific fame--Einstein is known for relativity because it replaced newton's gravity. No one remembers what he got his nobel prize for.
 

disgruntledgamer

New member
Mar 6, 2012
903
0
0
Falcon Stormvoice said:
It is estimated that a species cannot propagate itself with less that 5,000 members of that species in existence. Imagine if one of those 5,000 members was born with the mutation of a weird bump on his head. What would happen -- all of the females of his species would find him incredibly attractive and jump his bones and over a thousand generations later, the weird bump has become a horn that aids in survival? Or, if the weird creature was even allowed to mate at all, wouldn't the bump simply be absorbed into the gene pool and disappear? Now imagine that the weird-bump-creature is not just one of 5,000, but one out of several million. Even less likely now, isn't it? And I could go on about this all day, pointing out things, such as the reality that mutation is almost always a BAD thing for survival.

No, when you really stop to think about things objectively and critically, the millions and millions of layers of improbability surrounding evolutionary theory quickly turn into impossibility.
Can I have your Source please. I have a feeling either it's propaganda, misread or doesn't exist.
 

BiscuitTrouser

Elite Member
May 19, 2008
2,859
0
41
This is the single best explanation of evolutionary misconceptions i have seen. Now "Complicated psueudo science words" or anything. Basic and clear explanation.

 

DracoSuave

New member
Jan 26, 2009
1,685
0
0
Falcon Stormvoice said:
It is estimated that a species cannot propagate itself with less that 5,000 members of that species in existence. Imagine if one of those 5,000 members was born with the mutation of a weird bump on his head. What would happen -- all of the females of his species would find him incredibly attractive and jump his bones and over a thousand generations later, the weird bump has become a horn that aids in survival? Or, if the weird creature was even allowed to mate at all, wouldn't the bump simply be absorbed into the gene pool and disappear? Now imagine that the weird-bump-creature is not just one of 5,000, but one out of several million. Even less likely now, isn't it? And I could go on about this all day, pointing out things, such as the reality that mutation is almost always a BAD thing for survival.

I don't understand your rebuttal.

It shows a fundamental lack of understanding of how GENETICS work, never mind evolution.

In fact, how can you accept genetics and NOT accept evolution? Gene theory includes evolution theory as a part of it--as gene theory is the explanation for how heredity happens.

Let's take a different tack with this.


1) Do you agree or disagree that life reproduces itself?
1a) Assuming you agree, do you agree or disagree that there is a mechanism by which life can transfer some of its attributes to its offspring?
2) Do you agree or disagree that the process is imperfect, and that even something as simple as 'mommy has different hair than daddy' means that a child can end up with traits that neither parent have?
3a) Do you agree or disagree that sometimes living organisms possess traits that make them less likely to survive?
3b) Do you agree or disagree that sometimes living organisms possess traits that make mating more or less difficult, either through physical frailty, or through being less attractive to potential mates?

Mathematical analysis has proven that if 1a is true, 2 is true, and EITHER 3a OR 3b are true, evolution is not only possible, but a guaranteed inevitability. In order to disprove evolution as a process, you MUST disagree with 1a, 2, or 3a AND 3b.

Now, seeing as it's common knowledge that

a) animals can fuck,
b) animals that fuck have kids,
c) animals that fuck and have kids tend to have kids that are not like either parent but a mix
d) animals that fuck tend to want to fuck more fuckable animals
e) animals that fuck need to live long enough to fuck because dead things can't fuck

And that all of those are true for humans, where is your evidence or argument that evolution is false?

In other words, can you disprove that animals fuck?